arid4b sgrna sequences Search Results


90
GenScript corporation arid4b sgrna sequences
(A) Genotype distribution of progenies from the mating of <t>Arid4b</t> +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.
Arid4b Sgrna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arid4b sgrna sequences/product/GenScript corporation
Average 90 stars, based on 1 article reviews
arid4b sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


(A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Staining

(A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Transplantation Assay, Injection, Irradiation, Flow Cytometry

(A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Immunofluorescence, Staining, Flow Cytometry, Immunohistochemistry, Western Blot

(A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques:

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet:

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Blocking Assay, Recombinant, Electron Microscopy, Plasmid Preparation, Red Blood Cell Lysis, Protease Inhibitor, SYBR Green Assay, Transfection, Gene Expression, Software, Microscopy, Irradiation, Flow Cytometry